From raw reads to variants Anna Johansson Uppsala,

From raw reads to variants Anna Johansson Uppsala,

From raw reads to variants Anna Johansson Uppsala, February 2019 Talk Overview Concepts Reference genome Variants Paired-end data NGS Workflow Quality control & Trimming Alignment Local realignment PCR duplicates & removal Base Quality Score Recalibration

Variant calling VCF files Joint genotyping & gVCF files Annotation & Filtering Reference genome Genome Reference Consortium A mosaic nucleic acid sequence ...GTGCGTAGACTGCTAGATCGAAGA... Reference genome

Genome Reference Consortium A mosaic nucleic acid sequence ...GTGCGTAGACTGCTAGATCGAAGA... What changes between versions? First version: 150,000 gaps HG19: 250 gaps Variants A position where sample sequence does not agree with reference genome sequence Reference:

...GTGCGTAGACTGCTAGATCGAAGA... Variants A position where sample sequence does not agree with reference genome sequence Reference: Sample: ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... Variants Population based variant projects

Paired-end sequencing Paired-end data Illumina sequencing https://www.youtube.com/watch?v=fCd6B5HRaZ8 Paired-end data The forward and reverse reads are stored in two fastq files. ID_R1_001.fastq @HISEQ:100:C3MG8ACXX:5:1101:1160:2 197 1:N:0:ATCACG CAGTTGCGATGAGAGCGTTGAGAAGTATAATAGG

AGTTAAACTGAGTAACAGGATAAGAAATAGTGAG ATATGGAAACGTTGTGGTCTGAAAGAAGATGT + [email protected] JIHGIIJJJJIJIJIJJJJIIJJJJJIIEIHHIJ HGHHHHHDFFFEDDDDDCDDDCDDDDDDDCDC ID_R2_001.fastq @HISEQ:100:C3MG8ACXX:5:1101:1160: 2197 2:N:0:ATCACG CTTCGTCCACTTTCATTATTCCTTTCATACATG CTCTCCGGTTTAGGGTACTCTTGACCTGGCCTT TTTTCAAGACGTCCCTGACTTGATCTTGAAACG + CCCFFFFFHHHHHJJJJIJJJJJJJJJJJJJJJ JJJJJJJIJIJGIJHBGHHIIIJIJJJJJJJJI

JJJHFFFFFFDDDDDDDDDDDDDDDEDCCDDDD Paired-end data The forward and reverse reads are stored in two fastq files. The order of pairs and naming is identical, except the designation of forward and reverse. ID_R1_001.fastq @HISEQ:100:C3MG8ACXX:5:1101:1160:2 197 1:N:0:ATCACG CAGTTGCGATGAGAGCGTTGAGAAGTATAATAGG AGTTAAACTGAGTAACAGGATAAGAAATAGTGAG ATATGGAAACGTTGTGGTCTGAAAGAAGATGT + [email protected] JIHGIIJJJJIJIJIJJJJIIJJJJJIIEIHHIJ HGHHHHHDFFFEDDDDDCDDDCDDDDDDDCDC

ID_R2_001.fastq @HISEQ:100:C3MG8ACXX:5:1101:1160: 2197 2:N:0:ATCACG CTTCGTCCACTTTCATTATTCCTTTCATACATG CTCTCCGGTTTAGGGTACTCTTGACCTGGCCTT TTTTCAAGACGTCCCTGACTTGATCTTGAAACG + CCCFFFFFHHHHHJJJJIJJJJJJJJJJJJJJJ JJJJJJJIJIJGIJHBGHHIIIJIJJJJJJJJI JJJHFFFFFFDDDDDDDDDDDDDDDEDCCDDDD NGS workflow QC and trimming Alignment

FASTQ files SAM files Local Realignment Duplicate removal BAM files BQSR Variant calling

VCF files NGS workflow QC and trimming Alignment Local Realignment Duplicate removal BQSR Variant calling Quality control module load FastQC

Bad qualities: Good qualities: Quality control module load FastQC Adapters present: Adapters Absent: Trimming module load cutadapt / TrimGalore / trimmomatic 3' Adapter Remove bad quality reads Remove adapters

or 5' Adapter or Read Anchored 5' adapter Adapter Removed sequence NGS workflow QC and trimming Alignment

Local Realignment Duplicate removal BQSR Variant calling GATK Best Practices https://software.broadinstitute.org/gatk/best-practices/ Alignment module load bwa

Read Reference TCGATCC GACCTCATCGATCCCACTG Alignment module load bwa Read Reference TCGATCC GACCTCATCGATCCCACTG Read

Reference TCGATCC GACCTCATCGATCCCACTG Alignment module load bwa Alignment module load bwa Coverage Paired-end data & Alignment The known distance between paired reads allows improved

mapping over repeat regions Output from mapping - Sam format HEADER SECTION @HD @SQ @SQ @SQ @RG @RG @PG VN:1.0 SO:coordinate SN:1 LN:249250621 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:1b22b98cdeb4a9304cb5d48026a85128 SN:2 LN:243199373 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:a0d9851da00400dec1098a9255ac712e

SN:3 LN:198022430 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:fdfd811849cc2fadebc929bb925902e5 ID:UM0098:1 PL:ILLUMINA PU:HWUSI-EAS1707-615LHAAXX-L001 LB:80 DT:2010-05-05T20:00:00-0400 SM:SD37743 CN:UMCORE ID:UM0098:2 PL:ILLUMINA PU:HWUSI-EAS1707-615LHAAXX-L002 LB:80 DT:2010-05-05T20:00:00-0400 SM:SD37743 CN:UMCORE ID:bwa VN:0.5.4 ALIGNMENT SECTION 8_96_444_1622 73 scaffold00005 155754 255 54M * 0 0 ATGTAAAGTATTTCCATGGTACACAGCTTGGTCGTAATGTGATTGCTGAGCCAG [email protected])[email protected]@7 8_80_1315_464 81 scaffold00005 155760 255 54M = 154948 0 AGTACCTCCCTGGTACACAGCTTGGTAAAAATGTGATTGCTGAGCCAGACCTTC [email protected]?BA=>@>>7;AB 8_17_1222_1577 73 scaffold00005 155783 255 40M1116N10M * 0 0 GGTAAAAATGTGATTGCTGAGCCAGACCTTCATCATGCAGTGAGAGACGC [email protected]??>CCBA2AA 8_43_1211_347 73 scaffold00005 155800 255 23M1116N27M * 0 0 TGAGCCAGACCTTCATCATGCAGTGAGAGACGCAAACATGCTGGTATTTG #>8<=<@6/:@9';@7 8_32_1091_284 161 scaffold00005 156946 255 54M = 157071 0 CGCAAACATGCTGGTAGCTGTGACACCACATCAACAGCTTGACTATGTTTGTAA [email protected] Quality Start position

Sequence Read name Read groups Link information of sample id, library prep, flowcell and sequencing runs to fastq file. Good for error tracking! Detailed description in tutorial or

https://gatkforums.broadinstitute.org/gatk/discussion/6472/read-groups RGID = Read group identifier usually derived from the combination of the sample id and run id RGLB = Library prep identifier RGPL = Platform (for us ILLUMINA) RGPU = Run identifier usually barcode of flowcell RGSM = Sample name Convert to Bam Bam file is a binary representation of the Sam file NGS workflow QC and trimming

Alignment Local Realignment Duplicate removal BQSR Variant calling Local realignment Problem: Reads are mapped one read at a time, this sometimes leads to single variants being split into multiple variants Solution: Realign such a region taking all reads into account Local realignment module load GATK

Genome Analysis ToolKit RealignerTargetCreator IndelRealigner Local realignment, still needed? HaplotypeCaller (HC) Mutect2 NGS workflow QC and trimming Alignment Local

Realignment Duplicate removal BQSR Variant calling PCR duplicates & removal module load picard Occur during library preparation

Dont add unique information Optical duplicates NGS workflow QC and trimming Alignment Local Realignment Duplicate removal BQSR Variant calling Base Quality Score

Recalibration module load GATK Identifies and corrects systematic (non-random) technical errors made by the sequencer when estimating the quality score of each base call Correcting for over-/Underestimation of quality scores Helps fight false positive variant calls Rescues false negatives variant calls

Some errors can be due to the physics or chemistry of the sequencing reaction, some to manufacturing flaws in the equipment Errors are identified over several covariates, mainly related to sequence context, position in read or machine cycle NGS workflow QC and trimming Alignment Local Realignment Duplicate removal

BQSR Variant calling Variant calling Reference: Sample: ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... Variant calling Reference: Sample: ...GTGCGTAGACTGCTAGATCGAAGA...

...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... Variant calling Reference: Sample: ...GTGCGTAGACTGCTAGATCGAAGA...

...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... ...GTGCGTAGACTGCTAGATCGAAGA... ...GTGCGTAGACTGATAGATCGAAGA... = Variant Calling

HC'method'illustrated' HaplotypeCaller NGS workflow QC and trimming Alignment Local Realignment Duplicate removal BQSR Variant calling VCF Files

##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT= ##FORMAT=

#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO=

##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial

##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3

20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT=

##FORMAT= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO=

##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4

VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT=

##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO= ##INFO= ##INFO= ##INFO=

##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT= ##FORMAT= #CHROM POS 20 14370 20 17330 20 1110696

ID rs6054257 . rs6040355 REF ALT G A T A A G,T QUAL 29 3 67

FILTER PASS q10 PASS INFO NS=3;DP=14;AF=0.5;DB;H2 NS=3;DP=11;AF=0.017 NS=2;DP=10;AF=0.333,0.667;AA=T;DB VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial

##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4

VCF Files ##fileformat=VCFv4.0 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT=

##FORMAT= ##FORMAT= #FORMAT GT:GQ:DP:HQ GT:GQ:DP:HQ GT:GQ:DP:HQ NA00001 0|0:48:1:51,51 0|0:49:3:58,50 1|2:21:6:23,27 NA00002 1|0:48:8:51,51 0|1:3:5:65,3

2|1:2:0:18,2 NA00003 1/1:43:5:.,. 0/0:41:3 2/2:35:4 Joint genotyping gVCF Files gVCF ##GVCFBlock=minGQ=0(inclusive),maxGQ=5(exclusive) ##GVCFBlock=minGQ=20(inclusive),maxGQ=60(exclusive) ##GVCFBlock=minGQ=5(inclusive),maxGQ=20(exclusive)

Filtering module load GATK #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ VariantFiltration --filterExpression QUAL > 30 --filterName QUAL_filter --filterExpression "QUAL / DP < 10.0" --filterName QUALDP_filter Annotation module load annovar /snpEff / vep #CHROM POS ID REF ALT QUAL 20 14370 rs6054257 G A 29

Gene-based Non-synonymous/synonymous Region-based CpG-islands Conserved regions Predicted transcription factor binding sites Filter-based dbSNP 1000G COSMIC

Annotation module load annovar /snpEff / vep #CHROM POS ID REF ALT QUAL 20 14370 rs6054257 G A 29 Gene-based Non-synonymous/synonymous Region-based CpG-islands Conserved regions Predicted transcription factor binding sites

Filter-based dbSNP 1000G E COSMIC H E M A S E! C N T E SE FER U E

File naming conventions QC and trimming Alignment Local Realignment Duplicate removal BQSR Variant calling Use informative file

names create a new output file in each process Include description of process in output file name File naming conventions QC and trimming Sample.trimmed.fast q Alignment Sample.bam

Local Realignment Sample.realigned.ba m Duplicate removal Sample.dedup.bam BQSR Sample.bqsr.bam

Variant calling Sample.vcf Indices Most large files we work with need an index Different index for different file-types Bwa index creates one set of index for the reference that it needs for performing alignment Other programs like samtools produce other types of index for .fasta and .bam files needed by other programs 57 Flowchart of lab Index reference

genome Sample1: NA06984 read1.fq mapping processing read2.fq read1.fq Bwa mem AddOrReplaceReadGroups

AddOrReplaceReadGroups BuildBamIndex BuildBamIndex RealignerTargetCreator RealignerTargetCreator IndelRealigner IndelRealigner MarkDuplicates

MarkDuplicates BuildBamIndex BuildBamIndex BaseRecalibrator BaseRecalibrator PrintReads PrintReads Sample2.realign.dedup.recal.bam HaplotypeCaller

HaplotypeCaller NA00097.g.vcf Joint variant calling read2.fq Bwa mem NA00097.realign.dedup.recal.bam Variant calling Sample3

Sample2 Sample3.g.vcf Sample2.g.vcf GenotypeGVCFs AllSamples.vcf Variant filtration VariantFiltration AllSamples.filtered.vcf View in IGV Questions?

Questions? Work like a professional bioinformatician Google errors!

Recently Viewed Presentations

  • afaefafe - ITU

    afaefafe - ITU

    NGN Drivers: Access and core Networks, legacy services migration issues; Dr. Sathya Rao Telscom Consulting [email protected] The Network Evolution Key Technologies NGN CONCEPT Broadband (Access) for All Global 2005 Broadband Access Market Forecast Broadband Access Technologies xDSL Technologies Ethernet Access...
  • Multi-Robot Adversarial Patrolling: Facing Coordinated Attacks

    Multi-Robot Adversarial Patrolling: Facing Coordinated Attacks

    We model the cost of turning around by time, meaning if it turns around it costs the system an extra tau time units * * * Robot's movement is directed in the sense that if it has to visit a...
  • الشريحة 1 - Ksu

    الشريحة 1 - Ksu

    FURTHER RESULTS ON SYSTEMS OF EQUATIONS AND INVERTIBILITY. THEOREM 1.6.1. Every system of linear equations has no solutions, or has exactly one solution, or has infinitely many solutions. THEOREM 1.6.2. If A is an invertible . nxn. matrix, then for...
  • Common Question Why CCA ? Is there a

    Common Question Why CCA ? Is there a

    Leadership - roles in CCA, class, house or school activities. Achievement - representation, attainment & accomplishment. Participation - attendance in CCA, intra-school, NDP. Service - Community Service. For details , refer to Student Diary pg 24-31 or School Website.
  • Marketing Plan Outline - Pearson Education

    Marketing Plan Outline - Pearson Education

    Resources needed to support strategies and meet objectives Marketing Control Sales objectives Sales forecast and quotas Expenditures against budget Periodic evaluation of all marketing objectives Marketing activity timetable Readjustments to the marketing plan Presenting and Selling the Plan Preparing for...
  • PSYCHOLOGICAL DISORDERS - Houston Community College

    PSYCHOLOGICAL DISORDERS - Houston Community College

    Schizophrenia is the most chronic and debilitating of all psychological disorders. It affects men and women equally, occurs in similar rates across ethnicities and across cultures, and affects at any one time approximately 3 million people in the United States...
  • Congruent Triangles. Congruence Congruent Triangles 4-4 6-2 Postulates.

    Congruent Triangles. Congruence Congruent Triangles 4-4 6-2 Postulates.

    Holt Geometry Holt McDougal Geometry Warm Up 1. Name all sides and angles of ∆FGH. 2. What is true about K and L? Why? 3. What does it mean for two segments to be congruent? FG, GH, FH, F, G,...
  • Start of Inventions For: Day 2

    Start of Inventions For: Day 2

    First talking movie ever filmed was the "Jazz Singer." Animated pictures were first created using a devise called the "wheel of life." Impact on society: News, entertainment, job, created celebrities. Auguste & Louis Lumiere. Edison