Cell Division and Pathogens Pathobiology 552 Denise Galloway

Cell Division and Pathogens Pathobiology 552 Denise Galloway

Cell Division and Pathogens Pathobiology 552 Denise Galloway [email protected] The Cell Cycle Growth arrest vs. apoptosis Telomeres and telomerase Human papillomaviruses and the cell cycle Immortalization and transformation M- phase Segregation of chromosomes G2-phase Gap 2 G1-phase Gap 1

S phase Replication of DNA CYC D CDK 4 M G2 CYC B CDC 2 G1 S CYC A CDC 2 CYC E CDK 2

CYC A CDK 2 Transcription Binding of inhibitor Degradation (PEST, D-box) Cyclin CKI P - T14 Y15 Wee1/Myt-1 kinase CKI CD Kinase Cks

CDC25 phosphatase Binding of cyclin to CDK T161 - P CAK (CDK activating kinase) Control of G1/S Transition p16INK4A (p15, p18, p19) CYC D CDK4

Rb/p107/p130 CYC E CDK2 p21CIP1 (p27, p57) p53 ARF E2F HDAC HDAC HAT Ac

Ac X Ac Ac AcAc Ac Ac M G2 DNA Damage G1 p53

S p53 ATM/p53 Signaling Pathway ATM/p53 Signaling Pathway ATM Chk2 CDK2 p53 G1 arrest E p21 CDC2 B

G2 arrest S/M Re-rep. G1 S G1/S S G2 M G2/M Spindle G2/M

Oncogenes, DNA damage Hypoxia Redox kinases Growth factors ARF p53 MDM2 p21 Apoptosis

Growth arrest Pathogen infection stimulates apoptosis Why do cells need telomeres and telomerase? Linear chromosomes pose 2 problems for cells: 1. End-replication problem 2. Distinguishing chromosome ends from ds DNA breaks The end-replication problem DNA replication 5 leading strand lagging strand 3

RNA primer removal and Okazaki fragment ligation 5 3 Telomeres are protein/DNA protective structures at the ends of chromosomes telomeres telomeres 3 G-strand overhang ~ 10 Kb human ~ 40 Kb mouse TTAGGG AATCCC

Q-FISH to detect TTAGGG (PNA probes) TTAGGG AATCCC Telomere-binding proteins Rad50/Mre11/Nbs1 pot-1 tankyrase TRF1 PARP5 open telomere Ku Ku

tin2 telomerase Ku TRF2 DNA-PKcs TRF2 DNA-PKcs TRF1 closed telomere t-loop Telomere structure caps chromosome ends

Griffith 1999 G strand T-loop 5 hPOT1 3 TRF2 C strand TRF1 nucleosomes zoom in on telomere adapted from Neidle and Parkinson (2003) Current Opinion in Structural Biology Telomeres and telomerase

3 Telomerase hTERT hTR CCCAATCCCAATCCC5 AAUCCCAA GGGTTAGGGTTAGGGTTAGGGTTAGGGTT3 10-15 Kb ds telomeric DNA ~200 nt ss 3 overhang Regulation of telomerase expression Primarily by regulating expression of the hTERT catalytic subunit hTERT AAUCCCAA

The hTERT and hTR components are sufficient for in vitro activity. Kilian 1997, Meyerson 1997, Nakamura 1997 Expression of hTERT subunit is sufficient to induce telomerase activity in many different cell types. Bodnar 1998, Counter 1998, Vaziri and Benchimol 1998 While most somatic cells do not express hTERT, stem cells, germ cells, and tumor cells DO express hTERT. Kim 1994, Sharma 1995, Chiu 1996, Kolquist 1998 Regulation of hTERT expression Ac Ac Ac Ac Ac Ac

Ac Ac Ac Ac Ac Ac Ac Ac CpG Island Ac Ac TSA treatment to inhibit histone deacetylases induces Noincorrelation of DNA methylation with telomerase activity some cell types transcriptional

Cong 2000, Takakura 2001, Hou 2002activity of the promoter Chromatin modifications may play a key role in activity DNA Tumor Virus Oncoproteins SV40 Large T antigen Small T Ad pp2A E1A Rb E1B HPV

Rb, p53 E6 p53 p53, hTert E7 Rb The human papillomavirus Viral oncogenes LCR E6 E7

HPV L1 E1 ~8000 bp Viral capsid proteins E2 L2 E5 E4 Transcriptional control and viral

DNA replication Expression of viral genes in the stratified epithelium Virus release Late gene expression and capsid formation

Squamous Early gene expression and viral DNA replication Suprabasal HPV infects basal cells Basal Infected epithelium

Normal epithelium Basement membrane RB p107, p130 E2F Ub. RB p107, p130 E7 E2F

RB Mi-2 p21, p107, p130 p27 E7 TBP M2 Acid PK -gluc S4 ATPase c-jun, junB, junD, c-fos Ub Ub E6-AP

(E3 Ub. ligase) p53 E6 CBP/p300 ERC55 pax. GAP hScribble tyk2 MAGI E6 hDLG IRF3 Mupp1 Activates transcription MCM7 bax bak Represses transcription PKN Activates telomerase in epithelial cells

Targets of the E6 and E7 oncoproteins E7 E6 Rb E6-AP E2F S phase genes induces E6 p53 AAUCCCAA

telomerase activity E2F S phase genes Regulation of the G1/S transition p16INK4A (p15, p18, p19) CYC D CDK4 E7 PcG CYC E CDK2

p21CIP1 (p27, p57) Rb/p107/p130 HDAC E2F E6 p53 MDM2 ARF ? Working Model for regulation of the hTERT Promoter in Normal HFKs E

NFX1 -91 Myc Max Sin3A E X HDAC TERT Working Model for E6 Activation of hTERT ? Ac

? HAT Ac Myc Max NFX1-123 HAT Myc Max ? E Ac

Ac TERT E X Ac Ac E6 NFX1-91 E6AP Ac Ac HPV-16 E6 and E7 can efficiently immortalize epithelial cells

Population doublings + E6 + E7 + E6 or E7 Senescence Days in culture Induction of telomerase and loss of Rb/p16 pathway are required for immortalization of epithelial cells Population doublings + Telomerase AND Loss of Rb/p16 + Telomerase OR Loss of Rb/p16 Senescence

Days in culture HPV E7 Inactivation of Rb/p16/cyclin D HPV E6 Inactivation of p53/p21/ATM Block apoptosis Activation of telomerase Activation of genes for invasion, metastasis, angiogenesis

Recently Viewed Presentations

  • The Magnetic Origins of Solar Eruptions

    The Magnetic Origins of Solar Eruptions

    Times New Roman Blank Presentation Magnetic Topology and the Corona-Heliosphere Connection Basic Assumptions Slide 3 Conjecture: One CH per Polarity Region Slide 5 Slide 6 Slide 7 Slide 8 Slide 9 Topology of 3D Breakout Eruption Topology of Fully 3D...
  • Book Titles - Mesa Public Schools

    Book Titles - Mesa Public Schools

    Tahoma Arial Wingdings Calibri Times New Roman Slit 1_Slit MLA Creating a Works Cited/ In-text Citation using Word 2007 Underlined Titles "Titles in Quotation Marks" Long Quotation Example of Long Quote POEMS Poems Continued Poems continued Poems Continued In-Text Citation...
  • MS Thesis Defense - faculty.kfupm.edu.sa

    MS Thesis Defense - faculty.kfupm.edu.sa

    Fuzzy Simulated Evolution for Power and Performance of VLSI Placement Sadiq M. Sait Habib Youssef Junaid A. Khan Aimane El-Maleh Department of Computer Engineering
  • Lab Safety

    Lab Safety

    Lab SafetyCloze Notes . Lab Safety . Before. Listen to instructions . Use only the materials needed . Know the location of emergency equipment . Tie back long hair, roll up long sleeves, remove dangling jewelry . Lab Safety ......
  • Reducing Neuronal Systems to Discrete Dynamics

    Reducing Neuronal Systems to Discrete Dynamics

    Main Theorem (Terman, Ahn, Wang, Just; Physica D, 237(3) (2008)) Suppose a discrete model defined by a digraph is given. Then there re are intervals for the choice of the intrinsic parameters of the cells and the synaptic parameters in...
  • Acids, pH, and Buffers: Some Basic Chemistry for

    Acids, pH, and Buffers: Some Basic Chemistry for

    Acids, pH, and Buffers: Some Basic Chemistry for Biological Science Terry Platt University of Rochester * Paul Mathews has just learned about acidity in his chemistry class, and… surprises his parents with questions about the acidity of common substances, such...
  • Revisiting our practices: - PhET Interactive Simulations

    Revisiting our practices: - PhET Interactive Simulations

    Phet-based activities database on website--Trish Loeblein show website, sim list, balloons and sweater, moving man, elctromag run phet sims (all free!): directly from web (regular browser, platform independent) download whole website to local computer for offline use 2006-- 1 Million...
  • My 4th Quarter Allusion Project

    My 4th Quarter Allusion Project

    Allusion Story inArt. Odysseus and the Sirens . by John William Waterhouse (1891) illustrates the famous scene although he uses the bird woman format and increases the number of sirenstoseven. He captures their menacing nature while preserving some sort of...