If the mRNA codon is AUG what would the matching tRNA ...

If the mRNA codon is AUG what would the matching tRNA ...

DNA, RNA, AND MUTATIONS Study guide review IF THE mRNA CODON IS AUG WHAT WOULD THE MATCHING tRNA ANTICODON BE? UAC LIST THE EVENTS THAT TAKE PLACE

DURING PROTEIN SYNTHESIS IN ORDER. DNA serves as a template for mRNA production in nucleus- transcription mRNA moves to the cytoplasm and attaches to a ribosome; tRNA molecules

carrying amino acids bond to specific codons on mRNA and amino acids peptide bond together to build polypeptide-translation WHAT ARE THE SIDES OF A DNA MOLECULE MADE OF?

Sugar & phosphate group DEFINE GENE. A sequence of DNA that codes for a protein IF THE mRNA CODON FOR PROLINE IS

GGA WHAT WOULD BE THE DNA CODE (TRIPLET) FOR THIS AMINO ACID? CCT HOW MANY HYDROGEN BONDS FORM BETWEEN ADENINE & THYMINE?

2 HOW MANY HYDROGEN BONDS FORM BETWEEN CYTOSINE & GUANINE? 3 DEFINE ANTICODON.

A group of 3 nucleotides in tRNA that is complementary to mRNA WHERE DOES TRANSCRIPTION TAKE PLACE IN THE CELL? Nucleus

WHO WERE THE TWO PEOPLE THAT ARE CREDITED WITH THE DISCOVERY OF DNAS STRUCTURE? Watson and Crick DEFINE REPLICATION.

Process by which DNA is copiedresulting in two DNA molecules each with one new strand and one original strand -called semi-conservative

replication WHAT PART OF THE CELL CONTAINS DNA? Nucleus DEFINE TRANSCRIPTION.

Process by which DNA is used as a template to make mRNA. WHAT ARE THE BASE PAIRS THAT MAKE UP DNA? A-T,

C-G WHAT ARE THE COMPONENTS OF A NUCLEOTIDE? Phosphate group, 5-C sugar, nitrogenous base

DEFINE CODON. A set of 3 nucleotides in mRNA that are complementary to DNA DEFINE ANTICODON

a group of 3 nucleotides in tRNA that is complementary to mRNA IF A SEQUENCE OF DNA CONTAINS THE FOLLOWING BASES, WHAT WOULD THE COMPLEMENTARY BASE SEQUENCE BE? ATCGGATTAGCC

TAGCCTAATCGG DESCRIBE THE THREE DIFFERENT TYPES OF RNA & THEIR FUNCTION. mRNA carries the information of DNA from the

nucleus to the cytoplasm tRNA transfers each amino acid to the ribosome as it is specified by the coded messages in mRNA

rRNA aids in the assembly of proteins and makes up part of the ribosome WHERE DOES tRNA ATTACH? to a specific mRNA codon as it is read by the ribosome

WHERE ARE PROTEINS MANUFACTURED IN THE CELL? ribosomes WHAT IS THE GENETIC CODE?

The sequence of amino acids that give a person their genetic information. WHICH MOLECULE CARRIES THE ANTICODON?

tRNA WHAT DID CHARGAFF DISCOVER? Equal amounts of A & T and C &G in samples of DNAexplains base pairing

WHAT ARE THE NUCLEOTIDES FOUND IN DNA? A, T, C, G WHAT ARE THE NUCLEOTIDES FOUND IN RNA?

A, U, C, G HOW DID ROSALIND FRANKLIN STUDY DNA? X-RAY diffraction

DEFINE TRANSLATION. Process when the sequence of mRNA is decoded into a protein WHERE DOES TRANSLATION

OCCUR? Cytoplasm WHAT ARE INTRONS?

portions of RNA that are cut out and discarded WHAT ARE EXONS? remaining pieces of RNA after introns are cut out that are spliced back together to form the final mRNA

WHAT DOES RNA POLYMERASE DO? separates DNA strands and uses one strand of DNA as a template to assemble nucleotides into a complementary strand of mRNA

GIVE THE mRNA SEQUENCE FOR THE FOLLOWING DNA STRAND: AAGTATAC UUCAUAUG WHAT IS THE START CODON? WHICH AMINO ACID DOES IT CODE FOR?

AUG- methionine WHAT IS THE STRUCTURE OF DNA CALLED? WHO IS RESPONSIBLE FOR THIS NAME?

Double helix- Watson & Crick GIVEN THE FOLLOWING DNA SEQUENCE, HOW MANY AMINO ACIDS DOES IT CODE FOR? ATCCTTGATTCCGCA 5

15 bases= 5 codons= 5 amino acids WHAT DOES DNA STAND FOR? WHAT IS ITS PURPOSE?

Deoxyribonucleic acid- the molecule of heredity WHAT DOES RNA STAND FOR? WHAT IS ITS PURPOSE? Ribonucleic acid- carries out instructions coded in DNA

WHAT ARE THE DIFFERENCES BETWEEN DNA & RNA? Sugar # of Strands Bases

DNA deoxyribose 2 A, T,C, G RNA

ribose 1 A, U, C, G IN THE CYTOPLASM, MESSENGER RNA BECOMES ATTACHED TO THE

RIBOSOME EXPLAIN DNA REPLICATION. DNA helicase separates the double helix and then DNA polymerase synthesizes two new strands using originals as templates following

base pairing rules; produces two DNA molecules each with one new strand and one original strand WHAT MAKES UP A NUCLEOTIDE? phosphate group, 5-C sugar, nitrogenous base

WHERE IS mRNA SYNTHESIZED? NUCLEUS WHAT IS THE ENZYME RESPONSIBLE FOR REPLICATION? TRANSCRIPTION?

DNA polymerase- replication RNA polymerase- transcription DESCRIBE 5 MUTATIONS FOR DNA THAT LEAD TO BENEFICIAL OR HARMFUL CHANGES IN A GENE.

GENE Missense-substitution affects 1 amino acid Insertion and Deletion- changes reading frame

Nonsense- premature stop codon CHOMOSOME

Deletion- part of chromosome is lost Translocation- chromosomal rearrangements Inversions and insertions- sequencing issues

A RANDOM CHANGE IN AN ORGANISMS GENETIC INFORMATION IS A mutation A GROUP OF 3 NUCLEOTIDES IN tRNA THAT IS COMPLIMENTARY TO mRNA IS CALLED THE

anticodon DNA REPLICATION RESULTS IN TWO DNA MOLECULES EACH WITH ONE NEW STRAND AND ONE ORIGINAL STRAND.

TRUE or FALSE DESCRIBE MISSENSE, NONSENSE, AND SILENT MUTATIONS

Silent: does not change the amino acid sequence Missense: changes one amino acid in the resulting protein

Nonsense: premature stop codon shortens the resulting protein ALWAYS USE THE GIVEN TEMPLATE DNA! DNA template

TACAATTGCCCCCGGGCAATT Comp DNA ATGTTAACGGGGGCCCGTTAA

mRNA codons UAA AUG-UUA-ACG-GGG-GCC-CGU- amino acids

tRNA anticodons UAC-AAU-UGC-CCC-CGG-GCAAUU met-leu-thre-gly-ala-arg-stop

Recently Viewed Presentations

  • The Scientific Literatre - University of Michigan

    The Scientific Literatre - University of Michigan

    Times New Roman Default Design CS ChemDraw Drawing The Scientific Literature General 216 Announcements The Honors Cup The Proposal Goals for your Proposal Interesting Molecule or Process What is NOT a Synthetic Transformation? Extraction PowerPoint Presentation Where do I get...
  • D/RS 1013 - Bloomsburg University of Pennsylvania

    D/RS 1013 - Bloomsburg University of Pennsylvania

    D/RS 1013 Discriminant Analysis Discriminant Analysis Overview multivariate extension of the one-way ANOVA looks at differences between 2 or more groups goal is to discriminate between groups considers several predictor variables simultaneously Discriminant - Overview provides a way to describe...
  • Reading: Comprehension

    Reading: Comprehension

    Reading: Comprehension CHAPTER 9 GENERAL APPROACHES What are the main components of each of these approaches? Language Experience Approach (LEA) Whole Language Approach Source Material Using Literature Predictable Books High-Interest Low-Difficulty Books (HILD) Basal Reading Approach Comprehensive Programs COMPREHENSION STRATEGIES...
  • Using Prezi to design interactive, multi-scale, iterative concept

    Using Prezi to design interactive, multi-scale, iterative concept

    This TAR project is designed with a "what is?" approach to teaching and learning.: What are students learning in Earth Materials? How is multi-scale information integrated? What topics and relationships do students identify as important to the "big picture"? What...
  • Smallpox D. GOLDBERG PED ID SVCE WRAMC SMALLPOX

    Smallpox D. GOLDBERG PED ID SVCE WRAMC SMALLPOX

    SMALLPOX Genus Orthopoxvirus Smallpox, monkeypox, cowpox,vaccinia DNA Virus 200 nm brick shaped Smallpox-person to person spread via respiratory secretions/direct contact Spread best in low humidity/temperature SMALLPOX SMALLPOX 2 principle forms- variola major-Europe/Asia variola minor-19th ...
  • Project Sunlight & Its Impact on SUNY Nedra

    Project Sunlight & Its Impact on SUNY Nedra

    Video conference. Between State entity and an outside party: Purely intra-State meetings do not need to be reported ... to assure SUNY individuals before whom outside individuals and firms make reportable appearances complete the OGS form or convey notice of...
  • II. Classification of Matter

    II. Classification of Matter

    Matter Classification Matter Flowchart Pure Substances Mixtures A. Matter Flowchart MATTER Can it be physically separated? Homogeneous Mixture (solution) Heterogeneous Mixture Compound Element MIXTURE PURE SUBSTANCE yes no Can it be chemically decomposed? no yes Is the composition uniform? no...
  • Boys and Girls Learn Differently! Boys & Girls

    Boys and Girls Learn Differently! Boys & Girls

    Most likely you will not have time on the initial day of training. This slide can be used at a later date). * A good brain break at this point is "Tony Chestnut." You will need to link the sound...